473,803 Members | 3,410 Online
Bytes | Software Development & Data Engineering Community
+ Post

Home Posts Topics Members FAQ

Finding the lowest score

namcintosh
67 New Member
First of all, here is my program:

Expand|Select|Wrap|Line Numbers
  1. #include <iostream>
  2. #include <conio>
  3. using namespace std;
  4.  
  5. //Function prototype
  6. void getscore(int&, int&, int&, int&, int&);
  7. void findLowest (int, int, int, int, int, int);
  8. int main()
  9. {
  10.         int LO, score1, score2, score3, score4, score5;
  11.  
  12.         getscore (score1, score2, score3, score4, score5);
  13.         findLowest(LO, score1, score2, score3, score4, score5);
  14.  
  15.         getch();
  16.         return 0;
  17. }
  18.  
  19.  
  20.  
  21. void getscore (int &score1, int &score2, int &score3, int &score4, int &score5)
  22. {
  23.         cout << "Enter first score: ";
  24.         cin  >> score1;
  25.         cout << "Enter second score: ";
  26.         cin  >> score2;
  27.         cout << "Enter third score: ";
  28.         cin  >> score3;
  29.         cout << "Enter fourth score: ";
  30.         cin  >> score4;
  31.         cout << "Enter fifth score: ";
  32.         cin  >> score5;
  33. }
  34.  
  35. void findLowest(int LO, int score1, int score2, int score3, int score4, int score5)
  36. {
  37.  
  38.         LO = 1000;
  39.  
  40.         if (score1 < LO)
  41.         {
  42.             LO = score1;
  43.             cout << "The lowest score is" <<LO <<endl;
  44.         }
  45.  
  46.         else if (score2 < LO)
  47.         {
  48.             LO = score2;
  49.             cout << "The lowest score is" <<LO <<endl;
  50.         }
  51.         else if (score3 < LO)
  52.         {
  53.             LO = score3;
  54.             cout << "The lowest score is" <<LO <<endl;
  55.         }
  56.         else if (score4 < LO)
  57.         {
  58.             LO = score4;
  59.             cout << "The lowest score is" <<LO <<endl;
  60.         }
  61.         else if (score5 < LO)
  62.         {
  63.             LO = score5;
  64.             cout << "The lowest score is" <<LO <<endl;
  65.         }
  66. }
Okay, I got one part of the program to work right. The only problem is finding the lowest score.

I declared some if/else if statements and also assigned LO to a large number, such as 1000. Here's my output:

Expand|Select|Wrap|Line Numbers
  1. Enter first score: 100
  2. Enter second score: 75
  3. Enter third score: 55
  4. Enter fourth score: 100
  5. Enter fifth score: 85
  6. The lowest score is100
Do you see what I mean? It declares 100 as the lowest number. Why is it doing that?
Apr 20 '07
54 6640
Savage
1,764 Recognized Expert Top Contributor
Yes,and I know it.I wish that u learn so I have left one for u!! :D

Savage
Apr 20 '07 #11
Savage
1,764 Recognized Expert Top Contributor
Another thing:

Functions like these are not modular so I would rather use arrays for such function just in case that I feel need for it some time in future.


Savage
Apr 20 '07 #12
namcintosh
67 New Member
Yes,and I know it.I wish that u learn so I have left one for u!! :D

Savage
You have one more what

Is there any way that I can use it doing the if/else if statements
Apr 20 '07 #13
Savage
1,764 Recognized Expert Top Contributor
You have one more what

Is there any way that I can use it doing the if/else if statements
Well,in that case do it like:

S=score1;

Expand|Select|Wrap|Line Numbers
  1. if(s>score2) s=score2;
  2. else if(s>score3) s=score3;
  3.        else if(s>score4) s= score4;
  4.               else s=score5

this approach to reguires a same loop
Apr 20 '07 #14
namcintosh
67 New Member
Well,in that case do it like:

S=score1;

Expand|Select|Wrap|Line Numbers
  1. if(s>score2) s=score2;
  2. else if(s>score3) s=score3;
  3.        else if(s>score4) s= score4;
  4.               else s=score5

this approach to reguires a same loop
Oh. I though that at first all I could do was just declare LOW to be a large number and then do the if/else if statements to test it out. But I guess it didn't work because all of the numbers are smaller than 1000.
Apr 22 '07 #15
Savage
1,764 Recognized Expert Top Contributor
Oh. I though that at first all I could do was just declare LOW to be a large number and then do the if/else if statements to test it out. But I guess it didn't work because all of the numbers are smaller than 1000.
Even if there were number larger than 1000 it would not work as u planed.One more thing:

It can be done without using loop but then it would be done only and only by
using if,not if-else.

If u are intrested/intrigued by this let me know!!!

:D

Savage
Apr 22 '07 #16
namcintosh
67 New Member
Even if there were number larger than 1000 it would not work as u planed.One more thing:

It can be done without using loop but then it would be done only and only by
using if,not if-else.

If u are intrested/intrigued by this let me know!!!

:D

Savage
Oh, why Savage, please let me know. I am very interested. :-)
Apr 23 '07 #17
Savage
1,764 Recognized Expert Top Contributor
Glad to hear that!!

So here we go:

Start is the same:

int S=score1;

now to the important part:

Expand|Select|Wrap|Line Numbers
  1. if(S>score2) s=score2;
  2. if(S>score3) s=score3;
  3. if(s>score4) s=score4;
  4. if(s>score5) s=score5;
this is it.

Now to test it:

score1=10;
score2=15;
score3=8;
score4=12;
score5=9;

1) s=10;
2) s>15 no;
3) s>8 yes-> s=8;
4) s>12 no;
5) s>9 no;

6) s=8

As u can see it's 'alive' and working properly.

And why it would not work with LO and if-else?

It would not work becasue it's wrong logic to set number to random value,always instead set it to one of the scores and then search if there is a smaller number and secound that if-else chain would work only in loop.


Savage
Apr 23 '07 #18
fantasticamir
42 New Member
remove all of "else"s and it is gonna work!
Apr 23 '07 #19
namcintosh
67 New Member
Glad to hear that!!

So here we go:

Start is the same:

int S=score1;

now to the important part:

Expand|Select|Wrap|Line Numbers
  1. if(S>score2) s=score2;
  2. if(S>score3) s=score3;
  3. if(s>score4) s=score4;
  4. if(s>score5) s=score5;
this is it.

Now to test it:

score1=10;
score2=15;
score3=8;
score4=12;
score5=9;

1) s=10;
2) s>15 no;
3) s>8 yes-> s=8;
4) s>12 no;
5) s>9 no;

6) s=8

As u can see it's 'alive' and working properly.

And why it would not work with LO and if-else?

It would not work becasue it's wrong logic to set number to random value,always instead set it to one of the scores and then search if there is a smaller number and secound that if-else chain would work only in loop.


Savage

OK, so how can I get it to return a value
Apr 23 '07 #20

Sign in to post your reply or Sign up for a free account.

Similar topics

4
3805
by: Han | last post by:
Determining the pattern below has got my stumped. I have a page of HTML and need to find all occurrences of the following pattern: score=9999999999&amp; The number shown can be 5-10 characters in length. I would like to extract only the number, stripping off the "score=" and "&amp;".
4
4730
by: Porthos | last post by:
Hi All, I'm trying to find the minimum value of a set of data (see below). I want to compare the lengths of these attribute values and display the lowest one. This would be simple if I could re-assign values to a variable, but from what I gather I can't do that. How do I keep track of the lowest value as I loop through? My XSL document only finds the length of each string and prints it out (for now). I can write a template
3
6944
by: andreas.maurer1971 | last post by:
Hi all, since a few years I use the following statement to find duplicate entries in a table: SELECT t1.id, t2.id,... FROM table AS t1 INNER JOIN table AS t2 ON t1.field = t2.field WHERE t1.id < t2.id
6
1991
by: Matt Chwastek | last post by:
Anyone who can help, I am curretnly attempting to write some code that will allow iteration using a vector<intfrom the highest possilbe degree of a combination of ones & zeros (111, 110, 101, 011, 100, 010, 001, 000). The ordering of element containing the same number of ones is not important to the code, just the fact that the highest number of ones are iterated first. I would prefer not to use a binary string as eventually the
2
2022
sonic
by: sonic | last post by:
Does anyone know what I can do to this function to get it to drop the lowest value? Thanks for any insight. void sort(double* score, int size) { int startScan; int minIndex; double minValue;
5
6330
by: davenet | last post by:
Hi, I'm new to Python and working on a school assignment. I have setup a dictionary where the keys point to an object. Each object has two member variables. I need to find the smallest value contained in this group of objects. The objects are defined as follows:
1
3411
by: Flanders | last post by:
I have developed a small arcade game with the help of a few VB books. A scoring system was implemented in the design of the game but I as hoping that some one would be able to instruct me on how display the score at the end of the game. At the moment when a player finishes the game I have a window displaying "Puzzle Solved." If I could display the players score under this in the same window would be great. This is a quick copy and paste...
2
1830
by: marybrown | last post by:
i will write the complete problem i am facing. Here is the input file i am using. sxoght: #query hit score probability qstart qend qorientation tstart tend matches mismatches gapOpening gaps @SNPSTER4_104_308EFAAXX:1:1:1694:128 GGGATAAGAGAGGTGCATGTTGGTATTTAAGGTAGT 1 alignment(s) -- reports limited to 10 alignment(s) sxoght: SNPSTER4_104_308EFAAXX:1:1:1694:128 gi|122939163|ref|NM_000165.3| -10 ...
3
8904
by: hamishmcgee | last post by:
Ok, so for a project at university I have to create a High Score table in C++ with Visual Studio. Just to let you know this is my first year at university and also my first time ever learning C++. So far I have a working menu, which lets you enter in your name, highscore and date which then gets saved to a file and is outputted via another option on the menu. I had a lot of trouble gettin the user info to save to a file in the first place, then...
0
9700
marktang
by: marktang | last post by:
ONU (Optical Network Unit) is one of the key components for providing high-speed Internet services. Its primary function is to act as an endpoint device located at the user's premises. However, people are often confused as to whether an ONU can Work As a Router. In this blog post, we’ll explore What is ONU, What Is Router, ONU & Router’s main usage, and What is the difference between ONU and Router. Let’s take a closer look ! Part I. Meaning of...
0
9564
by: Hystou | last post by:
Most computers default to English, but sometimes we require a different language, especially when relocating. Forgot to request a specific language before your computer shipped? No problem! You can effortlessly switch the default language on Windows 10 without reinstalling. I'll walk you through it. First, let's disable language synchronization. With a Microsoft account, language settings sync across devices. To prevent any complications,...
0
10310
jinu1996
by: jinu1996 | last post by:
In today's digital age, having a compelling online presence is paramount for businesses aiming to thrive in a competitive landscape. At the heart of this digital strategy lies an intricately woven tapestry of website design and digital marketing. It's not merely about having a website; it's about crafting an immersive digital experience that captivates audiences and drives business growth. The Art of Business Website Design Your website is...
1
10292
by: Hystou | last post by:
Overview: Windows 11 and 10 have less user interface control over operating system update behaviour than previous versions of Windows. In Windows 11 and 10, there is no way to turn off the Windows Update option using the Control Panel or Settings app; it automatically checks for updates and installs any it finds, whether you like it or not. For most users, this new feature is actually very convenient. If you want to control the update process,...
0
9121
agi2029
by: agi2029 | last post by:
Let's talk about the concept of autonomous AI software engineers and no-code agents. These AIs are designed to manage the entire lifecycle of a software development project—planning, coding, testing, and deployment—without human intervention. Imagine an AI that can take a project description, break it down, write the code, debug it, and then launch it, all on its own.... Now, this would greatly impact the work of software developers. The idea...
1
7603
isladogs
by: isladogs | last post by:
The next Access Europe User Group meeting will be on Wednesday 1 May 2024 starting at 18:00 UK time (6PM UTC+1) and finishing by 19:30 (7.30PM). In this session, we are pleased to welcome a new presenter, Adolph Dupré who will be discussing some powerful techniques for using class modules. He will explain when you may want to use classes instead of User Defined Types (UDT). For example, to manage the data in unbound forms. Adolph will...
0
5498
by: TSSRALBI | last post by:
Hello I'm a network technician in training and I need your help. I am currently learning how to create and manage the different types of VPNs and I have a question about LAN-to-LAN VPNs. The last exercise I practiced was to create a LAN-to-LAN VPN between two Pfsense firewalls, by using IPSEC protocols. I succeeded, with both firewalls in the same network. But I'm wondering if it's possible to do the same thing, with 2 Pfsense firewalls...
0
5627
by: adsilva | last post by:
A Windows Forms form does not have the event Unload, like VB6. What one acts like?
2
3796
muto222
by: muto222 | last post by:
How can i add a mobile payment intergratation into php mysql website.

By using Bytes.com and it's services, you agree to our Privacy Policy and Terms of Use.

To disable or enable advertisements and analytics tracking please visit the manage ads & tracking page.