First of all, here is my program: - #include <iostream>
-
#include <conio>
-
using namespace std;
-
-
//Function prototype
-
void getscore(int&, int&, int&, int&, int&);
-
void findLowest (int, int, int, int, int, int);
-
int main()
-
{
-
int LO, score1, score2, score3, score4, score5;
-
-
getscore (score1, score2, score3, score4, score5);
-
findLowest(LO, score1, score2, score3, score4, score5);
-
-
getch();
-
return 0;
-
}
-
-
-
-
void getscore (int &score1, int &score2, int &score3, int &score4, int &score5)
-
{
-
cout << "Enter first score: ";
-
cin >> score1;
-
cout << "Enter second score: ";
-
cin >> score2;
-
cout << "Enter third score: ";
-
cin >> score3;
-
cout << "Enter fourth score: ";
-
cin >> score4;
-
cout << "Enter fifth score: ";
-
cin >> score5;
-
}
-
-
void findLowest(int LO, int score1, int score2, int score3, int score4, int score5)
-
{
-
-
LO = 1000;
-
-
if (score1 < LO)
-
{
-
LO = score1;
-
cout << "The lowest score is" <<LO <<endl;
-
}
-
-
else if (score2 < LO)
-
{
-
LO = score2;
-
cout << "The lowest score is" <<LO <<endl;
-
}
-
else if (score3 < LO)
-
{
-
LO = score3;
-
cout << "The lowest score is" <<LO <<endl;
-
}
-
else if (score4 < LO)
-
{
-
LO = score4;
-
cout << "The lowest score is" <<LO <<endl;
-
}
-
else if (score5 < LO)
-
{
-
LO = score5;
-
cout << "The lowest score is" <<LO <<endl;
-
}
-
}
Okay, I got one part of the program to work right. The only problem is finding the lowest score.
I declared some if/else if statements and also assigned LO to a large number, such as 1000. Here's my output: - Enter first score: 100
-
Enter second score: 75
-
Enter third score: 55
-
Enter fourth score: 100
-
Enter fifth score: 85
- The lowest score is100
Do you see what I mean? It declares 100 as the lowest number. Why is it doing that?
Apr 20 '07
54 6640 Savage 1,764
Recognized Expert Top Contributor
Yes,and I know it.I wish that u learn so I have left one for u!! :D
Savage
Savage 1,764
Recognized Expert Top Contributor
Another thing:
Functions like these are not modular so I would rather use arrays for such function just in case that I feel need for it some time in future.
Savage
Yes,and I know it.I wish that u learn so I have left one for u!! :D
Savage
You have one more what
Is there any way that I can use it doing the if/else if statements
Savage 1,764
Recognized Expert Top Contributor
You have one more what
Is there any way that I can use it doing the if/else if statements
Well,in that case do it like:
S=score1; - if(s>score2) s=score2;
-
else if(s>score3) s=score3;
-
else if(s>score4) s= score4;
-
else s=score5
this approach to reguires a same loop
Well,in that case do it like:
S=score1; - if(s>score2) s=score2;
-
else if(s>score3) s=score3;
-
else if(s>score4) s= score4;
-
else s=score5
this approach to reguires a same loop
Oh. I though that at first all I could do was just declare LOW to be a large number and then do the if/else if statements to test it out. But I guess it didn't work because all of the numbers are smaller than 1000.
Savage 1,764
Recognized Expert Top Contributor
Oh. I though that at first all I could do was just declare LOW to be a large number and then do the if/else if statements to test it out. But I guess it didn't work because all of the numbers are smaller than 1000.
Even if there were number larger than 1000 it would not work as u planed.One more thing:
It can be done without using loop but then it would be done only and only by
using if,not if-else.
If u are intrested/intrigued by this let me know!!!
:D
Savage
Even if there were number larger than 1000 it would not work as u planed.One more thing:
It can be done without using loop but then it would be done only and only by
using if,not if-else.
If u are intrested/intrigued by this let me know!!!
:D
Savage
Oh, why Savage, please let me know. I am very interested. :-)
Savage 1,764
Recognized Expert Top Contributor
Glad to hear that!!
So here we go:
Start is the same:
int S=score1;
now to the important part: - if(S>score2) s=score2;
-
if(S>score3) s=score3;
-
if(s>score4) s=score4;
-
if(s>score5) s=score5;
this is it.
Now to test it:
score1=10;
score2=15;
score3=8;
score4=12;
score5=9;
1) s=10;
2) s>15 no;
3) s>8 yes-> s=8;
4) s>12 no;
5) s>9 no;
6) s=8
As u can see it's 'alive' and working properly.
And why it would not work with LO and if-else?
It would not work becasue it's wrong logic to set number to random value,always instead set it to one of the scores and then search if there is a smaller number and secound that if-else chain would work only in loop.
Savage
remove all of "else"s and it is gonna work!
Glad to hear that!!
So here we go:
Start is the same:
int S=score1;
now to the important part: - if(S>score2) s=score2;
-
if(S>score3) s=score3;
-
if(s>score4) s=score4;
-
if(s>score5) s=score5;
this is it.
Now to test it:
score1=10;
score2=15;
score3=8;
score4=12;
score5=9;
1) s=10;
2) s>15 no;
3) s>8 yes-> s=8;
4) s>12 no;
5) s>9 no;
6) s=8
As u can see it's 'alive' and working properly.
And why it would not work with LO and if-else?
It would not work becasue it's wrong logic to set number to random value,always instead set it to one of the scores and then search if there is a smaller number and secound that if-else chain would work only in loop.
Savage
OK, so how can I get it to return a value
Sign in to post your reply or Sign up for a free account.
Similar topics |
by: Han |
last post by:
Determining the pattern below has got my stumped.
I have a page of HTML and need to find all occurrences of the following
pattern:
score=9999999999&
The number shown can be 5-10 characters in length. I would like to extract
only the number, stripping off the "score=" and "&".
|
by: Porthos |
last post by:
Hi All,
I'm trying to find the minimum value of a set of data (see below).
I want to compare the lengths of these attribute values and display
the lowest one.
This would be simple if I could re-assign values to a variable,
but from what I gather I can't do that. How do I keep track of the
lowest value as I loop through? My XSL document only finds the length
of each string and prints it out (for now). I can write a template
|
by: andreas.maurer1971 |
last post by:
Hi all,
since a few years I use the following statement to find duplicate
entries in a table:
SELECT t1.id, t2.id,...
FROM table AS t1 INNER JOIN table AS t2
ON t1.field = t2.field
WHERE t1.id < t2.id
|
by: Matt Chwastek |
last post by:
Anyone who can help,
I am curretnly attempting to write some code that will allow iteration
using a vector<intfrom the highest possilbe degree of a combination
of ones & zeros (111, 110, 101, 011, 100, 010, 001, 000). The ordering
of element containing the same number of ones is not important to the
code, just the fact that the highest number of ones are iterated first.
I would prefer not to use a binary string as eventually the
|
by: sonic |
last post by:
Does anyone know what I can do to this function to get it to drop the lowest value? Thanks for any insight.
void sort(double* score, int size)
{
int startScan;
int minIndex;
double minValue;
| |
by: davenet |
last post by:
Hi,
I'm new to Python and working on a school assignment.
I have setup a dictionary where the keys point to an object. Each
object has two member variables. I need to find the smallest value
contained in this group of objects.
The objects are defined as follows:
|
by: Flanders |
last post by:
I have developed a small arcade game with the help of a few VB books. A
scoring system was implemented in the design of the game but I as hoping
that some one would be able to instruct me on how display the score at the
end of the game. At the moment when a player finishes the game I have a
window displaying "Puzzle Solved." If I could display the players score
under this in the same window would be great.
This is a quick copy and paste...
|
by: marybrown |
last post by:
i will write the complete problem i am facing. Here is the input file i am using.
sxoght: #query hit score probability qstart qend qorientation tstart tend matches mismatches gapOpening gaps
@SNPSTER4_104_308EFAAXX:1:1:1694:128
GGGATAAGAGAGGTGCATGTTGGTATTTAAGGTAGT
1 alignment(s) -- reports limited to 10 alignment(s)
sxoght: SNPSTER4_104_308EFAAXX:1:1:1694:128 gi|122939163|ref|NM_000165.3| -10 ...
|
by: hamishmcgee |
last post by:
Ok, so for a project at university I have to create a High Score table in C++ with Visual Studio. Just to let you know this is my first year at university and also my first time ever learning C++.
So far I have a working menu, which lets you enter in your name, highscore and date which then gets saved to a file and is outputted via another option on the menu. I had a lot of trouble gettin the user info to save to a file in the first place, then...
|
by: marktang |
last post by:
ONU (Optical Network Unit) is one of the key components for providing high-speed Internet services. Its primary function is to act as an endpoint device located at the user's premises. However, people are often confused as to whether an ONU can Work As a Router. In this blog post, we’ll explore What is ONU, What Is Router, ONU & Router’s main usage, and What is the difference between ONU and Router. Let’s take a closer look !
Part I. Meaning of...
|
by: Hystou |
last post by:
Most computers default to English, but sometimes we require a different language, especially when relocating. Forgot to request a specific language before your computer shipped? No problem! You can effortlessly switch the default language on Windows 10 without reinstalling. I'll walk you through it.
First, let's disable language synchronization. With a Microsoft account, language settings sync across devices. To prevent any complications,...
| |
by: jinu1996 |
last post by:
In today's digital age, having a compelling online presence is paramount for businesses aiming to thrive in a competitive landscape. At the heart of this digital strategy lies an intricately woven tapestry of website design and digital marketing. It's not merely about having a website; it's about crafting an immersive digital experience that captivates audiences and drives business growth.
The Art of Business Website Design
Your website is...
|
by: Hystou |
last post by:
Overview:
Windows 11 and 10 have less user interface control over operating system update behaviour than previous versions of Windows. In Windows 11 and 10, there is no way to turn off the Windows Update option using the Control Panel or Settings app; it automatically checks for updates and installs any it finds, whether you like it or not. For most users, this new feature is actually very convenient. If you want to control the update process,...
|
by: agi2029 |
last post by:
Let's talk about the concept of autonomous AI software engineers and no-code agents. These AIs are designed to manage the entire lifecycle of a software development project—planning, coding, testing, and deployment—without human intervention. Imagine an AI that can take a project description, break it down, write the code, debug it, and then launch it, all on its own....
Now, this would greatly impact the work of software developers. The idea...
|
by: isladogs |
last post by:
The next Access Europe User Group meeting will be on Wednesday 1 May 2024 starting at 18:00 UK time (6PM UTC+1) and finishing by 19:30 (7.30PM).
In this session, we are pleased to welcome a new presenter, Adolph Dupré who will be discussing some powerful techniques for using class modules.
He will explain when you may want to use classes instead of User Defined Types (UDT). For example, to manage the data in unbound forms.
Adolph will...
|
by: TSSRALBI |
last post by:
Hello
I'm a network technician in training and I need your help.
I am currently learning how to create and manage the different types of VPNs and I have a question about LAN-to-LAN VPNs.
The last exercise I practiced was to create a LAN-to-LAN VPN between two Pfsense firewalls, by using IPSEC protocols.
I succeeded, with both firewalls in the same network. But I'm wondering if it's possible to do the same thing, with 2 Pfsense firewalls...
|
by: adsilva |
last post by:
A Windows Forms form does not have the event Unload, like VB6. What one acts like?
| |
by: muto222 |
last post by:
How can i add a mobile payment intergratation into php mysql website.
| |