Python Forum

Hi Friends, I wrote a python script for file transferring through Rabbitmq application and it was working fine. The program was made into run and after 4 days the following error is coming.... timeout : timed out After then if i again run the script it was working and after 3 or 4 days again the same error is coming. The error message...

Hello! Recently I've decided to try something new and started watching the google tutorials for python (http://www.youtube.com/watch?v=haycL41dAhg) ... most of it was very clear and I've learned a lot... but since I am using a Win 7 and the man presenting is using a Mac, there were some difficulties... so my question here is... how do I start a...

I have a dictionary which is made pretty as a matrix: Dictionary: {'1': {'3': 0, '2': 1, '5': 1, '4': 0, '6': 29}, '3': {'1': 0, '2': 0, '5': 0, '4': 1, '6': 1}, '2': {'1': 13, '3': 1, '5': 21, '4': 0, '6': 0}, '5': {'1': 39, '3': 0, '2': 1, '4': 0, '6': 14}, '4': {'1': 1, '3': 1, '2': 17, '5': 2, '6': 0}, '6': {'1': 0, '3': 43, '2': 0,...

I need to make a function that determines the overlap between 2 sequences, and then return the overlap. The overlap is a coherent sequence that is in the left end of the first sequence, and in the right end of the second sequence. my sequences are: s1= "CGATTCCAGGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC" s2=...

Hi, I would like to create a 2d array of objects ex. 50 by 40 cells containing a Tile object each, but I can't figure out how to declare this structure. Built-in array structure doesn't seem to be able to contain custom data, but I might be wrong. I'd really appreciate if someone could help me out! Thanks, AClap

Hello, I want start a new web project using Python, but i want to know if using CGI is a good idea ? CGI: www.mydomain.com/cgi-bin/index.cgi or Python: www.mydomain.com/index.py

I need to query a printer as to whether it has a bitmap loaded to the memory before printing. Is there a quick command to query if the memory is empty (as in after a power cycle) or data in the memory?

I try to make scrolling on an Entry in python. when I run program nothing happen. Please any one help me?? this is my code: self.scrollbar = tk.Scrollbar(self,orient="horizontal") self.e3 =tk.Entry(self,xscrollcommand=self.scrollbar.set) self.e3.focus() self.e3.pack(side="bottom",fill="x")

I'm trying to run with Python 3.3: import lib2to3 import sys import string import xlrd workbook = xlrd.open_workbook(r'C:\....xlsx',encoding_override="cp1252") worksheet = workbook.sheet_by_name('Sheet1') workbook.sheet_names() ..................

I was successful on embedding a matpotlib bar graph onto tkinter, however I can seem to find a way to disply text underneat each bar. The desired result would be text displaying the content of each bar underneath, for example bar 1, bar 2, bar 3, bar 4, bar 5, any help would be greatly apperciated. Happy holidays to all the programming...

def quiz(): for count in range(1): import time print ("hello and welcome to my input output quiz") time.sleep(2) print() print("INTRUCTIONS") time.sleep(2) print() print(" you will a choice of 4 possible answers to chose from")

def on_button1_clicked(self, widget, data=None): con = MySQLdb.connect('localhost', 'root', 'warriors', 'reg'); with con: cur = con.cursor() sql_st="INSERT INTO regg (username, password) VALUES ('ra','%s')" cur.execute(sql_st) print "It has been inserted successfully "

Hi guys, Very new to Python and was hoping you guys could give me some help. I have a book about The Great War, and want to count the times a country appears in the book. So far i have this: Accesing the book >>> from __future__ import division >>> import nltk, re, pprint >>> from urllib import urlopen

Hii guys I'm new to python and I'm trying to import mssql data to mysql using python.. #!/usr/bin/python import MySQLdb import pyodbc

I need to close the session but the debug can't be shut down...wth do I do?

I am using ubuntu how I write my program from terminal to file and then how I open python file in terminal to run. Where should be file saved

I was attempting to change a value within a dictionary list via a list variable. However it does not change. Is this a feature of a Dictionary list or am I doing something incorrect? Thank you in advance for any assistance. user_id = account = {'username':user_id, 'password':user_id, 'first_name':user_id, 'last_name':user_id,...

This program runs and then at the end where i select the entire database and read it out to the console i see the results. The issue i am having is that when i go to the actual access database there is no changes and it is still blank. import os import adodbapi database = "db1.mdb" constr = 'Provider=Microsoft.Jet.OLEDB.4.0; Data...

hi, in Matlab i can define a function on a interval(use chebfun) the code like this : v=chebfun('c',) x=sin(v)+cos(v) y=sin(v)-cos(v) plot(x,y) then got a figure of x versus y when v is in interval .

Can anyone tell me how to write a regular expression that will match strings that either has only lower case or only upper case characters in it. For example, it will match AM, PM, am or parrot but not match Am, aM, Pm or Parrot.

Hello, I'm having some problems with python 2.6 and I fount the same problem with python 3.2.2 I've never noted that before until today. When I referenciate an array to a var and after that referenciate part of this array to another var and finely change an item of this second var, the first var have the item changed also. For instance...

Hi all, I would like to send an email from my Gmail account using python so when i have an error ill receive an auto email. At current the program handles the errors internally and keeps trying to do its task. That part is fine but when it hits an error I would like to receive an email. So i did some googling and found this nice script import...

my dictionary looks like this pri={2000:{0.233:0,0.444:0}} i want to store it in below given format 2000 0.233 0.444 how to do that?? thanks in advance

If this is the input: a b c I want to have this: 1 a 2 b 3 c

I am using PyOpenCL. I pass a array of floats to the OpenCL kernel. When the floats are returned, python can't use the types C types and has strange values:8.27548023e-36 8.27548310e-36, etc. float myFunc(float number, float iter_val) { float output; // Beginning of FOR loop #1 for(0;iter_val-1>0;){