reversing string in python

[python101]

I intend use string and reverse function to build a simple application in python for DNA (presented by A,G,G, and T) mutation when one of its substring is reversed during the replication process. The reversal happens what are termed inverted pairs. For instance, if the pattern TGAA is later followed byinverted pattern AAGT, the slice of DNA delimited by those patterns could be inverted and reattached. Something's like

TGAACATTAAGT
will be inversed to
TGAATTACAAGT

---------------------------------
The program is simple but I don't know how to manipulate the string to make it be reversed in the way I would like to. Here is my incomplete design:

DNAsequence = raw_input('Please enter a DNA sequence :')  #First, people have  to enter a DNA sequence (A,C,G,T only).
pattern= raw_input('please enter the pattern :') # Second, people have to enter the pattern (also A,C,G,T only)  this limited to 4 characters.
MutatedDNA ='......'  #this is the output I would like to have, a mutated sequence of DNA
 

[ilikepython]

I intend use string and reverse function to build a simple application in python for DNA (presented by A,G,G, and T) mutation when one of its substring is reversed during the replication process. The reversal happens what are termed inverted pairs. For instance, if the pattern TGAA is later followed byinverted pattern AAGT, the slice of DNA delimited by those patterns could be inverted and reattached. Something's like

TGAACATTAAGT
will be inversed to
TGAATTACAAGT

---------------------------------
The program is simple but I don't know how to manipulate the string to make it be reversed in the way I would like to. Here is my incomplete design:

DNAsequence = raw_input('Please enter a DNA sequence :')  #First people have  to enter a DNA sequence (A,C,G,T only).
pattern= raw_input('please enter the pattern :') # Second people have to enter the pattern (also A,C,G,T only)  
MutatedDNA ='......'  #this is the output I would like to have, a mutated sequence of DNA
 

To reverse:

>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>>
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
 

[python101]

thank you I got the principle, I will try to see how far I can go.

Anyway, what command(s) should I use if there is another letter rather than A,C,G,T used in the first and second input (if there is a error of inputing, there will be a message appear so user can re-input)?

[ilikepython]

thank you I got the principle, I will try to see how far I can go.

Anyway, what command(s) should I use if there is another letter rather than A,C,G,T used in the first and second input (if there is a error of inputing, there will be a message appear so user can re-input)?

import string
letts = string.lowercase
letts.remove("a")
letts.remove("c")
letts.remove("g")
letts.remove("t")
 
bad = 0
for let in user_input.lower():
    if let in letts:
        bad = 1
 
... or ...
 
us = user_input.lower()
if us.count("a") + us.count("c") + us.count("g") + us.count("t") < len(us):
    bad = 1
else:
    bad = 0
 

[python101]

Fished the basic, however, I would like to have something advanced:
- I want to inverse ALL occurrences of the input pattern (if there is more than one) in the DNAsequence. Display the new inversed sequence (other none-inversed in DNA sequence + inversed pattern(s) in proper index as example above, not only the inversed pattern). How can I do so?

[ilikepython]

Fished the basic, however, I would like to have something advanced:
- I want to inverse ALL occurrences of the input pattern (if there is more than one) in the DNAsequence. Display the new inversed sequence (other none-inversed in DNA sequence + inversed pattern(s) in proper index as example above, not only the inversed pattern). How can I do so?

Like this?

seq = "TCGA"
dna = "TCGAGATCTAGTCATCTAGCTCGATCGAAAGTCTATCGATCGGAT"
print dna.replace(seq, seq[::-1])
 

[python101]

I appreciate your help. Now I'd like to extend the program, instead of inversing the pattern we enter, we inverse the next pattern after the entered pattern. For example

dna = 'TACAAATCGGAC'
pat = 'AATC'

result will be 'TACAAATCACGG'?

[ilikepython]

I appreciate your help. Now I'd like to extend the program, instead of inversing the pattern we enter, we inverse the next pattern after the entered pattern. For example

dna = 'TACAAATCGGAC'
pat = 'AATC'

result will be 'TACAAATCACGG'?

You mean the last part should be 'CAGG'?

def indexList(s, item, i = 0):    # Thanks to bvdet for code
    i_list = []
    while 1:
        try:
            i = s.index(item, i)
            i_list.append(i)
            i += 1
        except:
            break
    return i_list
 
dna = 'TACAAATCGGAC'
pat  = 'AATC'
 
for i in indexList(dna, pat):
    nex = dna[i + 4:i + 8]
    dna = dna.replace(nex, nex[::-1])
 

See if that works.

[python101]

I have just begun learning python in a few days. Your code looked so complicated for me to understand. Can you explain in more details or can you make the code less complicated?

Like the simple code of ilikepython

>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
 

it works well. From this source code, can we extend it to achievement my goal?

[ilikepython]

I have just begun learning python in a few days. Your code looked so complicated for me to understand. Can you explain in more details or can you make the code less complicated?

Like the simple code of ilikepython

>>> s = "CATT"
>>> s[::-1]
'TTAC'
>>> ls = list(s)
>>> ls.reverse()
>>> "".join(ls)
'TTAC'
 

it works well. From this source code, can we extend it to achievement my goal?

Well, the code I gave you doesn't quite work right. Sorry. Let's try this:

 
dna = 'TACAAATCGGAC'
pat  = 'AATC'
 
for i in indexList(dna, pat):
    nex = dna[i + 4:i + 8]  # pattern after; to be reserved
    here = dna[i:i + 4]    # pattern (pat)
    dna = dna.replace(here + nex, here + nex[::-1]) # replace the combination with the last pattern reversed
 

Don't worry about the code in indexList, just know what it does. It returns a list of the indices of the item in the list s. So:

ls = [1, 2, 2, 4, 5, 2, 4]
indexList(ls, 2) will return [1, 2, 5]
indexList(ls, 4) will return [3, 6]
indexList(ls, 1) will return [0]
indexList(ls, 7) will return []
 

Does that make sense?

[python101]

I modified a little bit the source you gave me earlier, it worked quite well (only inversed the pattern we enter, not the next pattern after the pattern we entered). The new source code makes more sense. Thank U very much.

[python101]

The program seems to reverse only the first next pattern but not all in the sequence.

For example

dna = 'AACCTTGGAATTCATTAACCACGGAATTCATT'
pat ='AACC'
will only reversed to
dna = AACCGGTTAATTCATTAACCACGGAATTCATT'

[ilikepython]

The program seems to reverse only the first next pattern but not all in the sequence.

For example

dna = 'AACCTTGGAATTCATTAACCACGGAATTCATT'
pat ='AACC'
will only reversed to
dna = AACCGGTTAATTCATTAACCACGGAATTCATT'

I'm pretty sure it works:

def indexList(s, item, i = 0):    # Thanks to bvdet for code
    i_list = []
    while 1:
        try:
            i = s.index(item, i)
            i_list.append(i)
            i += 1
        except:
            break
    return i_list
 
 
def getNew(dna, pat):
    for i in indexList(dna, pat):
        nex = dna[i + 4:i + 8]  # pattern after; to be reserved
        here = dna[i:i + 4]    # pattern (pat)
        dna = dna.replace(here + nex, here + nex[::-1]) # replace the combination with the last pattern reversed
    return dna
 
 
dna = 'AACCTTGGAATTCATTAACCACGGAATTCATT'
pat ='AACC'
 
print "OLD: %s" % dna
dna = getNew(dna, pat)
print "NEW: %s" % dna
 

[python101]

Thank you very mich, I have a problem when running the source code.

For example,

dna ='AGGTGGTTAGGTGGTT'
pa='AGGT'
 
#the output is fine
result='AGGTTTGGAGGTTTGG
 

however, if it changes the last pattern of the dna

dna ='AGGTGGTTAGGTTGGT'
pa='AGGT'
 
#the output is not good
result='AGGTTTGGAGGTTGGT
 

I'm also looking for a code without using while. I want something very basic since I'm just a beginner.

[bvdet]

Thank you very mich, I have a problem when running the source code.

For example,

dna ='AGGTGGTTAGGTGGTT'
pa='AGGT'
 
#the output is fine
result='AGGTTTGGAGGTTTGG
 

however, if it changes the last pattern of the dna

dna ='AGGTGGTTAGGTTGGT'
pa='AGGT'
 
#the output is not good
result='AGGTTTGGAGGTTGGT
 

I'm also looking for a code without using while. I want something very basic since I'm just a beginner.

The while and for statements are the two basic loop constructs in Python and are good for a beginner to learn. I made some changes to ilikepython's code:

# Reverse the sequence(s) in 'dna' following the substring defined by 'pat'def getNew(dna, pat):
def getNew(dna, pat):
    for i in indexList(dna, pat):
        j = len(pat)
        revstr = dna[i + j:i + j*2]
        dna = revstr[::-1].join([dna[:i+j], dna[i+j*2:]])
    return dna
 

You still need function indexList().

[python101]

How can I print the output out(the mutated DNA)? I got error message.

How can I make the program run without being interrupted (after input the dna and pat, it outputs the result, then it appears the input again,...) when I want it to stop I type 'exit' and 'quit' to make it stop running?

[bartonc]

How can I print the output out(the mutated DNA)? I got error message.

How can I make the program run without being interrupted (after input the dna and pat, it outputs the result, then it appears the input again,...) when I want it to stop I type 'exit' and 'quit' to make it stop running?

# Use lots of comments
# to describe your program
 
# put imports at the top
import sys
 
def CheckDNASequence(sequence):
    # just a stub
    return True
 
 
# "encapsulate" using functions
def GetDNASequence():  # use descriptive names
    while 1:  # alway loop
        seq = raw_input("Enter a sequence ('q' to quit): ")
        if seq.lower() == "q":
            return  # break out of the loop, returning None
        if CheckDNASequence(seq):  # break out of the loop
            break
    return seq # good practice to put the valid return here
 
def GetPattern():
    pat = raw_input("Enter a pattern: ")
    return pat
 
 
def main():
    while True:  # always loop
        seq = GetDNASequence()
        if seq is None:
            sys.exit()
        print seq
        pat = GetPattern()
        print pat
 
if __name__ == "__main__":
    main()